Products | Vector Systems

Bacillus megaterium Expression Systems - FAQ

Bacillus megaterium Expression Systems
button Introduction
button Order Information
button Downloads
button Literature
button FAQ

  1. Are the B. megaterium vectors high or low copy no. vectors?

  2. Can the vectors be used in other Bacillus species?

  3. What amount of protein will be secreted?

  4. Do you have references and data about already expressed proteins?

  5. Does a methylation of the dna influnce the transformation efficiency?

  6. Is it possible to use electroporation to transform B. megaterium?

  7. What B. megaterium strain do you approve? Do you have information and references about this strain?

  8. What is the usual transformation rate with the protoplasts I purchased from you?

  9. Is a RBS present in the vectors pMM152x, pHIS152x, pSTREP152x?

  10. What is the sequence of the PxylA promoter and the RBS?

  11. Where is the start codon?

  12. I am trying to clone my gene into the pMM1525 vector at the Kas I site as this enables complete removal of the signal peptide sequence from the target protein. But I am facing problems with digesting the vector with Kas I enzyme so is there any site other than Kas I which enables complete removal of the signal peptide sequence.

  13. I would like to understand how cloning in the KasI / SfoI site enables complete removal of the signal peptide sequence

  14. Do I have to introduce the start codon of my gene of interest when I clone it downstream of the signal peptide?

  15. Do I have to introduce a STOP codon?

  16. Which E. coli strains are possible cloning hosts?

  17. Was the endogeneous xylose isomerase gene knocked out?

  18. Is there an alternative to use SfoI for cloning?

  19. In pHIS1525: is it possible to get rid of the His-tag by placing a stop codons at the end of my gene, before the His-tag?

  20. I notice that pMM1522 has the repU gene which is essential for plasmid replication. Is this for E. coli or B. megaterium? I am currently using pWH1520 from you and do not get great plasmid yields from E. coli. Is there a significant difference in protein productions between the two?

  21. Does the vector pMM1522 contain a transcription terminator downstream of the MCS? Or do I need to insert a transcription terminator downstream of my gene of interest?
  1. Q.: Are the B. megaterium vectors high or low copy no. vectors?
    A.: The copy no. for pWH1520 in B. megaterium and E. coli was not exactly determined. The copy no. of the precursor plasmid ( pBC16 and pBR327) is determinate for B. subtilis (possibly very similar in B. megaterium) and for E. coli.:
    pBC16 (ori for Bacillus): 200 copies in B. subtilis from
    (M. Monod et al., J Bacteriol. 1986 July; 167 (1): 138–147 )
    pBR327 (ori for E. coli): 15-20 copies in E. coli
    (Covarrubias L et al. Gene. 1981 Jan-Feb;13(1):25-35). Our experience is, that the vectors behave like high copy vectors during cloning in E.coli.
    Top
  2. Q.: Can the vectors be used in other Bacillus species?
    A.: Yes, pWH1520 is successfully transformed in other Bacillus species. You will find a lot of literature on the web. Please note that the xylose induction might be a problem for some species, e.g. B. subtilis has no xylose uptake system.
    Top
  3. Q.: What amount of protein will be secreted?
    A.: Sorry, but we do not have detailed information on protein secretion levels available. The secretion level is dependent on the protein characteristics, e.g. size, charge and many more. Thus it is very difficult to estimate how proteins will be behave. Following you will find two references with examples which could be helpful for you:

    Malten, M. et al., Production and secretion of recombinant Leuconostoc mesenteroides dextransucrase DsrS in Bacillus megaterium. Biotechnol. Bioeng. (2004).

    Barg, H., Malten, M., Jahn, M.and Jahn, D. (2005). Protein and vitamin production in Bacillus megaterium. In: J. L. Barredo (Eds.), Microbial Processes and Products, Humana Press Inc., Totowa, pp. 165-184.
    Top


  4. Q.: Do you have references and data about already expressed proteins?
    A.: Yes. For Examples of expressed proteins and for references please look here.

    Top
  5. Q.: Does a methylation of the DNA influence the transformation efficiency?
    A.: No. A methylation is not needed for a successful transformation in B. megaterium
    Top

  6. Q.: Is it possible to use electroporation to transform B. megaterium?
    A.: No. Many groups tried this, but we do not know anyone who met it with success. If you can do it, please let us know.
    Top
  7. Q.: What B. megaterium strain do you approve? Do you have information and references about this strain?
    A.: The plasmids were tested in B. megaterium strain WH320. We offer protoplasts ready for transformation from this strain. A good reference is Hillen et al., Arch Microbiol 1991, 155: 535-542.
    Top
  8. Q.: What is the usual transformation rate with the protoplasts I purchased from you?
    A.: The usual transformation rate is 1000 to 3000 cfu per µg DNA. It is difficult to determine the exact number in the top agar tube because the colonies are grown on top of each other.
    Top
  9. Q.: Is a RBS present in the vectors pMM152x, pHIS152x, pSTREP152x?
    A.: All vectors (pMM152x, pHIS152x, pSTREP152x) contain an RBS upstream of the BsrG I site. The only differences between these vectors is the presence of the coding sequence of the signalpeptide in pMM1525, pHIS1525 and pSTREP1525. That means it is possible to clone the gene of interest in the MCS in parallel (in pHIS1525 downstream of the coding sequence of the signal peptide). Please clone into the right reading frame as marked by the Start codon for xylA.
    Top
  10. Q.: What is the sequence of the PxylA promoter and the RBS?
    A.: PxylA: ttgaaataaacatttattttgtatatgat
    The RBS has the following sequence: AAGGGGG
    Reference: (Rygus et al., 1991)
    Top
  11. Q.:Where is the start codon?
    A.: The reading frame starts at the ATG directly downstream of the BsrG I (TGTACA) site
    Reference: (Rygus et al., 1991)
    Top
  12. Q.: I am trying to clone my gene into the pMM1525 vector at the Kas I site as this enables complete removal of the signal peptide sequence from the target protein. But I am facing problems with digesting the vector with Kas I enzyme so is there any site other than Kas I which enables complete removal of the signal peptide sequence.
    A.: Also in our hands Kas I was a bad cutter, Nar I is a bit better and Sfo I is cutting best, but has the disadvantage of creating a blunt end. Hence, we developed a strategy to clone into the Sfo I site via a fast too step orcedure avoiding the restriction of high concentrated DNA using Sfo I. This is also outlined in the recent Malten et al. (2006) publication in Applied and Environmental Microbiology. In its supplemental material it says:

    “Next the part of the L. reuteri levansucrase gene, encoding an active and soluble protein in E. coli, was introduced into the various constructed vectors. The gene of LevΔ773MycHis including the N-terminal Myc-epitope and the His6-tag coding sequence was amplified by PCR using primers PCR1 and PCR2 with pBAD-lev (4) as template. In order to obtain the original N-terminus of the mature levansucrase, the gene had to be cloned directly downstream of the signal peptide encoding sequence. For this purpose the gene was firstly inserted into another restriction site of the MCS, here the SacI site. The employed primer PCR1 including the SacI site for cloning carried an additional downstream SfoI site, while a SphI site was encoded in primer PCR2. Cloning of the SacI/SphI digested PCR fragment into the appropriately cut pMM1525 resulted in pMMBm6. The resulting preliminary plasmid contained a linker region between the coding sequence of the signal peptide and target protein. This linker contained two SfoI sites – one in the sequence encoding the signal peptide cleavage site of pMM1525 and one inserted via the primer of the PCR product. This linker was quickly eliminated by SfoI digestion and subsequent religation to obtain a plasmid encoding SPlipA directly followed downstream by the target gene resulting in plasmid pMMBm7. The vector encodes SPlipA directly upstream to the coding sequence of LevΔ773MycHis.“ (Malten et al., 2006)

    ......................SacI.....SfoI
    Primer: PCR1 TTATTGAGCTCTGGCGCCGATCAAGTAGAAAGTAACAATTACAACG

    ........PCR2 CAAGAGCATGCTGAAAATCTTCTCTCATC

    Top
  13. Q.: I would like to understand how cloning in the Kas I / Sfo I site enables complete removal of the signal peptide sequence
    A.: By cloning using Sfo I you can fuse amino acids directly to the last amino acids (AGA) of the signal peptide. The signal peptidase recognizes this sequence and can cleave behind it, so that the N-terminus of your protein is as you desire. Please notice that there are some exceptions for the first amino acid following AGA - please see next question.
    Top
  14. Q.: Do I have to introduce the start codon of my gene of interest when I clone it downstream of the signal peptide?
    A.: Do not incorporate the start codon again, but start with the second codon of your gene of interest. For good processing by the signal peptidase the signal peptidase cleavage site (AGA) may be followed by an alanine (… AGAA…). Other aminoacids at the N-terminus are allowed. In Bacillus subtilis the following amino acids occur at this position in secreted proteins: A, Q, E, K, D,V, F, N, L, D, T (Antelmann et al., 2001).

    Below you see pMM1525 showing the signal peptide and the open reading frame with its MCS. Cloning in SfoI allows to choose the N-terminal amino acid freely. Cloning in Bgl II results in an alanine (A) at the N-terminus of the secreted protein.
    MCS of pMM1525
    Top


  15. Q.:Do I have to introduce a STOP codon?
    A.: Not if you want to have a protein fused to the polyhistidine tag. For this fusion please make sure that the 5` site of your gene is inserted within the correct reading frame.
    Top
  16. Q.: Which E. coli strains are possible cloning hosts?
    A.: All usually used E. coli cloning hosts can be used. The xylA promoter is not tightly controlled in E. coli. It is tightly controlled in B. megaterium.
    Top
  17. Q.: Was the endogeneous xylose isomerase gene knocked out?
    A.: In the strain WH320 the xylA gene is not knocked out, so that the inducer xylose is consumed over time.
    Top
  18. Q.:Is there an alternative to use Sfo I for cloning?
    A.: Yes, you can use Nar I which does produce overhanging ends. Futhermore, we employed an easy technique avoiding the use of Sfo I in the direct cloning step - (see question 14).
    Top
  19. Q.: In pHIS1525: is it possible to get rid of the His-tag by placing a stop codons at the end of my gene, before the His-tag?
    A.: Yes, this is certainly possible.
    Top
  20. Q.:I notice that pMM1522 has the repU gene which is essential for plasmid replication. Is this for E. coli or B. megaterium? I am currently using pWH1520 from you and do not get great plasmid yields from E. coli. Is there a significant difference in protein productions between the two?
    A.: There are not many differences between pWH1520 and pMM1522. The functional elements in both vectors are the same. pMM1522 is based on pWH1520. For construction of pMM1522 we removed a cre (catabolite reresponse element) - sequence in the open reading frame of the beginning of the xylA-gene, the original MCS of pWH1520 and an useless part of a tetracycline-resistence-gene for E. coli. Downstream of the promoter PxylA we cloned a new MCS. After this an additional site for the restriction enyzme BsrG I was inserted upstream of the Spe I site. All elements for plasmid replication in E. coli are the same in both vectors. Please notice that these shuttle vectors are not high copy in E. coli, because they contain the colE1 origin of pBR322. We often increased plamid yield by increasing the culture time. The repU-gene is necesarry for plasmid replication in B. megaterium. In our opinion there should be no difference in amount of plasmid between these two plasmids yields from E. coli But of course difference in protein amounts in B. megaterium based on the lack of the cre-sequence in pMM1522.
    Top
  21. Q.:Does the vector pMM1522 contain a transcription terminator downstream of the MCS? Or do I need to insert a transcription terminator downstream of my gene of interest?
    A.: No, pMM1522 and all other vectors of this series do not contain a terminator sequence. But it is not necessary to insert a terminator sequence. This was found in experiments comparing vectors with and without terminator. Here the terminator showed no effect on the amount of produced protein.
Top

 

Bacillus megaterium Expression Systems
button Introduction
button Order Information
button Downloads
button Literature
button FAQ
   

See also chapter 4 of our online catalog.

     
   
    top